HRP labeled secondary antibodies were detected using ECL (Amersham Biosciences, Little Chalfont, UK) and autoradiography. Lentivirus Production and Infection HEK 293FT cells were transfected with DNA-Lipofectamine complexes (Invitrogen, Carlsbad, USA) containing pVPR��8.71, pVSVG and LKO-Tet-ON vector [52]. till The next day, 1 mM sodium pyruvate and 10 mM sodium butyrate were added to the medium for 8 h. Virus was harvested 24 h later, filtered and titrated in MIA PaCa-2 cells. Cells were spinfected at 2000 rpm for 2 h in medium containing Tet-free FCS and 8 ��g/ml polybrene at an MOI=1. Medium was changed 8�C16 h post-infection, and puromycin selection was started and maintained after 30 h of recovery at 1 ��g/ml. Target sequences of shRNAs: K-RAS sh236: 5�� GATACAGCTAATTCAGAATC 3��; K-RAS sh562: 5�� AGGCTCAGGACTTAGCAAGA 3��; shNT: 5�� GGATAATGGTGATTGAGATGG 3��.
Proliferation Assay Cells were plated in 96 well plates with 6 replicates per condition. The next day, doxycycline was added at 200 ng/ml and changed every 3 days. Cells were fixed in glutaraldehyde at indicated days, stained in methylene blue, washed, the dye was eluted in 3% HCl, and the plates were read at OD=650 nm. Statistics were calculated by performing a t-test; p-values <0.05 were considered statistically significant. In cases where the equal variance or the normality test failed, a Whitney- Mann test was performed. For determination of GI50 values, cell lines were plated in 96 well plates. The next day, cells were treated with the AKT inhibitor MK2206 at compound concentrations ranging from 10 ��M to 1 nM (from 20 ��M to 1 nM for treatment with the PI3K inhibitor GDC0941 or the MEK inhibitor AZD6244).
After an incubation of 72 h, cells were fixed and stained as described above. Conditions were done in duplicate, and at least 2 independent experiments were performed for each cell line. qPCR RNA was isolated from frozen tumor powder and 2 ��g RNA were reverse transcribed (Applied Biosystems, Foster City, USA). qPCR reactions were performed with 40 ng of transcribed RNA (qPCR core kit for SYBR Green, Eurogentec, Liege, Belgium) using following primers designed to be human-specific and to cross an exon-intron boundary: K-RAS: forward 5�� ctaaatcatttgaagatattcacc 3��; reverse 5��ctgatgtttcaataaaaggaattc 3��. qPCR of RPS18 was done using the TaqMan probe 4319413E (Applied Biosystems).
Statistics were calculated by performing a t-test; p-values <0.05 were considered statistically significant. In cases where the equal variance or the normality test failed, a Whitney-Mann test was performed. Immunohistochemistry Tumors were fixed after dissection in 10% neutral buffered formalin for 24 h at RT, rinsed in PBS, processed for dehydration, cleared and paraffinized. Brefeldin_A After embedding in paraffin, 3 ��m sections were prepared.